Microbotryum stellariae on Water Chickweed (Myosoton aquaticum) 10.10.17 (5)

Professor Michael Hood from Amherst College, Amherst, MA USA, has kindly DNA tested for me, specimens of anther smut (Microbotryum stellariae ) from samples of Water Chickweed (Myosoton aquaticum) that I sent to him after I found it at RSPB Minsmere on 10.10.2017 (seen also back on 15.10.2016 but not tested).
Thanks to Michael, he noticed the anther smut on photos in my Wild Flowers - White album, on Flickr. These photos were taken on 15.10.2016 and I visited the year after (last year) on 10.10.2017 and found the anther smut still there in 3 different areas where the Water Chickweed (Myosoton aquaticum) was growing.
For the technicians among you here are some of Michael’s comments and also the DNA sequence ;
‘’We were able to get the DNA sequence data on the specimen you collected. The particular DNA region is involved in the machinery for making proteins (the ribosomal RNA), and it is the most common region used to discriminate species. And then there is a database search that allow comparison of DNA sequences to known species, called BLAST. The fungus you collected is the most similar to Microbotryum stellariae in the database, nearly identical. This species is indexed here: www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=110227
The first reference, under a different species name at the time, was by Sowerby in 1803 in a series called "Coloured Figures of English Fungi," image pasted below.
The DNA sequence is shown below as well ;
Microbotryum from Myosoton aquaticum (ribosomal RNA spacer regions)
TCGGGGGGTCTATAAGCTTTCCACTTTTCCCAGGCCAGCCATTACACCCCGGTAAAGGGATGCCATGTCCTCAGCGAATAGTCTATTACACCGAGTCAATCTGATCTCGAAGATTAGGATGCTAATGCATTACGAACGAGCTTCGACTCTAGAATCCCCCAAAAGGAATCCCAGTCCAGCAAACGTTCAGAAACCAAGCCGCGCCCCAATCTCCATAAGAAAAAGGGGGGGTTGAAGAGTTCACGACACTCAAACAGACTGCTCGCCGGAATACCAGCGAGCGCAGATGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCCATTACTTATCCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTTTTTGTTATATAATTTCTTTTTTCCCATACCATTGACTTTAAATGTTTAATAAAACGAGCGGGCACAAATTCCTGGCAAAGCTAATCGCCTTTCCTTGGCCCCCCCATTAGAAGTGCACAGAGTTTGAAAAAGTGAGAGGNCACGCCCTGGTTAAACAGGTACGCTATAAATTCACTAATGATCCTTCCGCAGGTTACCTACGGAAGGACAATAGNGAAGTATAGCGTAC

Mark Joy 8.4.2018

Taken on: October 10, 2017

Tags:

Anther smut (Microbotryum stellariae ) on Water Chickweed (Myosoton aquaticum)

10.10.17” RSPB

Suffolk Wild

Flowers

White Water

Chickweed Myosoton

aquaticum « less

Sets appears in: • FUNGI IN SUFFOLK • WILD FLOWERS WHITE

Groups appears in: • Photography • fungi more » • canon photography • Mushroom Project • British Wildlife • Flickritis: over 87,000 waiting for a vaccine. • anything is ok • - I LOVE NATURE - • Nature Art Gallery • Wild flowers • Nature Photography • AutumnWatch -> WinterWatch -> SpringWatch -> SummerWatch • ANYTHING ALLOWED!!!!!! • Awesome Nature • Fungus amoungus • Nature Heals the Soul • British Fungi and Lichens • Mushroom • Nature Watch UK • Mushrooms and Fungi • Funghi Fanatics • Fungi fun • Your Best Photography • mushrooms of all kinds • Micologia • Mycology • Mushroom paddestoel • Wild Flowers Everwhere • "Unlimited Photos: No Rules" • MARIPOSAS&BIRDS&FLORA&FAUNA&BUTTERFLY • Mushroom Anatomy 101 • fungi photo's • mushies • Mushrooms, fungus, moss, mold, and growths! • CANON-NO LIMIT • Mushrooms, fungi - Houby • Mushrooms & other fungi (Your Fab Fungi Fotos, FFF) • british wildlife no birds • Flora of the British Isles: A Photographic Guide • Fungi: All Shapes and Sizes • Fungi UK • Mushrooms - huby • Great British Wildlife • Mushrooms - Setas • Fungoroom • Nature's Gallery - No 30/60 Limit • Digital Camera World • Canon EOS Cameras. • EOS Experience • Fungi Family • CANON DSLR EXPERIENCE - (TR) - • Canon Users DSLR • !*ALL ARE WELCOME*! • Nature and all that is beautiful • Fungi From Around The World • Great Nature Shots • mushrooms and fungus • Flores, flores, flores y más flores • All Nature Lovers • PLANET ANIMAL (animal planet) • Flickr Photo Unlimited (No People) • Mushrooms and lichens « less

Camera: Canon EOS 7D, f/8.0, 1/15 sec, 60mm (=0mm), ISO 100 (more info) (hide info)

Camera:	Canon EOS 7D
Aperture:	f/8.0
Exposure Time:	0.067 sec (1/15)
Focal Length:	60mm (35mm equivalent: 0mm)
ISO:	100
Exposure Bias:	0 EV
Flash:	On, Fired
Exposure Program:	Manual
Exposure Mode:	Manual
Metering Mode:	Multi-segment
White Balance:	Auto
Color Space:	sRGB
Software:	Adobe Photoshop Elements 9.0 Windows
Show full info

Stats: 1,650 views

go back

Link to this photo view:
Link to this photo large view: